Banco de dados de questões do vestibular perguntas e respostas comentadas
questões de vestibulares
|
 

Questões Uerj-2005

REF. Pergunta/Resposta
origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:As estatinas, por seu grande êxito na prevenção da doença coronariana, estão entre os medicamentos mais prescritos no mundo. Essas substâncias atuam sobre a enzima que regula a síntese de colesterol pelo fígado, denominada, simplificadamente, de HMG-CoA redutase.
Para testar a eficiência de vários derivados de estatinas, utilizou-se uma preparação de HMG-CoA redutase isolada de tecido hepático. A velocidade de reação dessa preparação enzimática foi medida em função de concentrações crescentes de seu substrato HMG-CoA, na ausência e na presença de uma concentração fixa de três derivados de estatina. Nesses experimentos, o pH, a temperatura, a concentração da enzima e a concentração dos co-fatores necessários foram sempre mantidos constantes. O gráfico a seguir representa os resultados encontrados; a curva 1 foi obtida na ausência de estatinas.




a) Nomeie o tipo de mecanismo de ação das estatinas sobre a enzima HMG-CoA redutase hepática e justifique sua resposta.
b) Aponte uma substância sintetizada a partir do colesterol em nosso organismo, não caracterizada como hormônio, e sua respectiva função.

resposta:a) Inibição competitiva.
Na inibição enzimática do tipo competitivo, o inibidor, mantido em concentração constante, exerce seu efeito com maior intensidade em concentrações baixas de substrato. Com o aumento da concentração do substrato, devido ao efeito competitivo, a inibição tende a diminuir. Dessa forma, em excesso de substrato, a velocidade máxima de reação é a mesma na ausência ou na presença do inibidor.

b) Uma dentre as substâncias e respectiva função:
- sais biliares - emulsificação de gorduras durante a digestão.
- vitamina D (Dƒ) - metabolismo do cálcio e desenvolvimento do tecido ósseo.

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:Bactérias de duas espécies foram cultivadas separadamente e em conjunto, nas mesmas condições experimentais e com suprimento constante do mesmo tipo de alimento.
No gráfico a seguir, as curvas mostram a variação da densidade populacional das bactérias estudadas em função do tempo de cultivo. As curvas 1 e 2 representam os resultados encontrados para as duas espécies quando cultivadas separadamente e as curvas 3 e 4, quando cultivadas em conjunto.




A relação ecológica estabelecida entre as bactérias que melhor explica os resultados encontrados é classificada como:
a) predação
b) parasitismo
c) competição
d) comensalismo


resposta:[C]

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:A mutação em um gene, por conseqüência da substituição de uma única base na estrutura do DNA, pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene.
Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são:
5 AUGUGGUUUGCACACAAAUGAUAA 3 (normal)
5 AUGUGGUUUGAACACAAAUGAUAA 3 (alterada)
A tabela a seguir identifica alguns códons.




Observe que:
- o códon da metionina é também o do início da tradução;
- os códons de término da tradução são UAA, UAG e UGA.
O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são, respectivamente:
a) lisina e cisteína
b) treonina e triptofano
c) alanina e ácido glutâmico
d) fenil alanina e ácido aspártico

resposta:[C]

origem:Uerj
tópico:
Biologia

sub-grupo:Imunologia

pergunta:A função do sistema imunológico é a de defender o organismo contra invasores. Bactérias, vírus, fungos, tecidos ou órgãos transplantados, e mesmo simples moléculas, podem ser reconhecidos pelo organismo como agentes agressores.

a) Os gráficos a seguir mostram a variação da concentração de anticorpos contra um determinado antígeno no sangue de uma pessoa, em função do tempo, em duas condições: vacinação ou soroterapia.




Um dos gráficos mostrados corresponde à variação da concentração de anticorpo antiofídico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. Justifique por que esse tratamento deve ser feito logo após a picada do animal e, por que, em casos mais graves, deve ser repetido a intervalos de tempo relativamente curtos.

b) Na eritroblastose fetal, a mãe produz anticorpos contra o fator Rh do filho. A doença só se manifesta, porém, a partir da segunda gravidez. Indique a condição que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que não produzem fator Rh. Explique por que, mesmo nessas circunstâncias, o primeiro filho nunca é afetado.

resposta:a) Porque o soro antiofídico já apresenta os anticorpos apropriados prontos, produzidos em outro animal. Quando administrado logo após a picada, atingem rapidamente níveis elevados no sangue, neutralizando prontamente a toxina da serpente.
No entanto, esses níveis também caem rapidamente, como mostrado no gráfico 1. Por essa razão, nos casos mais graves, a aplicação deve ser repetida até que toda a toxina inoculada seja neutralizada.

b) O feto deve ser capaz de produzir fator Rh, ou seja, ser Rh®.
Como a produção inicial de anticorpos pela mãe Rh­ contra o fator Rh fetal é pequena, esses anticorpos não chegarão a transpor com eficiência, na primeira gestação, a barreira placentária que separa a circulação materna da fetal.

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:Os conhecimentos atuais de biologia celular, biologia molecular e engenharia genética podem, muitas vezes, estabelecer com segurança o parentesco entre pessoas, mesmo quando elas pertencem a gerações afastadas entre si.
O heredograma a seguir mostra os descendentes do casal João e Maria.




Atualmente, de toda essa família, apenas Maria e todos os seus bisnetos estão vivos, e se apresentaram para a identificação de herdeiros do casal citado. Por não haver documentos legais comprobatórios da relação de parentesco, nem ser possível a coleta de material genético dos membros falecidos da família, foi utilizada, dentre outras, a técnica de identificação por meio do estudo do DNA extranuclear.

Indique o número de:
a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza, por técnicas que determinam a homologia entre amostras de DNA extranuclear, e justifique sua resposta;
b) netos e bisnetos de João e Maria que possuíram ou possuem o cromossomo Y idêntico ao de João e justifique sua resposta.

resposta:a) 2 do sexo masculino e 2 do sexo feminino.
Nas condições propostas, homologias entre amostras de DNA só seriam possíveis se fossem comparadas amostras de origem mitocondrial. Como as mitocôndrias dos embriões formados originam-se, na grande maioria dos casos, diretamente dos óvulos, só poderíamos obter aproximadamente 100% de homologia comparando o DNA mitocondrial de Maria com os de seus bisnetos e bisnetas cujas mães e avós sejam descendentes diretos de Maria.

b) 2 netos e 1 bisneto.
O cromossomo Y é único e característico do sexo masculino. Esse cromossomo existe em cerca de 50% dos espermatozóides mas não em óvulos. Cromossomos Y homólogos ao de João serão encontrados, portanto, nos netos do sexo masculino descendentes dos filhos homens de João, e nos bisnetos de sexo masculino que sejam filhos destes netos.

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:Um pesquisador verificou que a substância por ele estudada apresentava como efeito, em meio de cultura de linfócitos, a diminuição da concentração intracelular do íon potássio. A explicação admitida pelo pesquisador para essa diminuição foi a ocorrência de alterações na função de, pelo menos, um dos seguintes sistemas: a bomba de sódio-potássio, os canais de transporte passivo de potássio ou a síntese de ATP na célula.
Os gráficos a seguir mostram possíveis alterações nas funções de cada um desses sistemas; o ponto 0 representa a função normal, na ausência da substância estudada, e o sinal positivo e o negativo representam, respectivamente, o aumento e a diminuição da função.




O gráfico no qual cada um dos três sistemas apresenta uma alteração compatível com o efeito da substância é o de número:
a) I
b) II
c) III
d) IV


resposta:[A]

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:Células do tipo X absorvem a substância S apenas por transporte ativo. Essa absorção, em células do tipo Y, é feita por transporte passivo mediado por um transportador específico.
Num experimento, foram medidas as velocidades iniciais de transporte de S através das membranas plasmáticas de X e de Y, em função de concentrações crescentes dessa substância no meio extracelular. O experimento foi repetido, então, em presença de um inibidor da geração de ATP nas células.
Observe a tabela, que resume as condições do experimento, e o gráfico a seguir.




As curvas que representam as medidas obtidas, respectivamente, nas condições experimentais I, II, III e IV, são:
a) 1 - 2 - 1 - 3
b) 2 - 3 - 2 - 2
c) 2 - 3 - 2 - 3
d) 3 - 3 - 1 - 1


resposta:[B]

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:Uma pessoa ingeriu, em uma refeição, somente pão, clara de ovo e azeite. A seguir, foram medidas, em função do tempo, em amostras coletadas no lúmen de diversos compartimentos de seu tubo digestivo, as concentrações de algumas substâncias:

- compartimentos: boca - estômago - duodeno - jejuno - íleo - cólon ascendente;
- substâncias: amido - proteína - triglicerídeos - peptídeos - glicose.

O gráfico a seguir representa os resultados encontrados para apenas uma das substâncias analisadas, no jejuno e no íleo. As concentrações dessa substância, medidas nos demais compartimentos, mantêm-se, ao longo do tempo, muito baixas, não estando, por isso, representadas no gráfico.




a) Identifique a substância cuja variação de concentração nos diversos compartimentos, durante os processos de digestão e absorção, deve corresponder à mostrada no gráfico. Explique como chegou a essa conclusão.

b) Descreva a atuação do suco pancreático na digestão dos ácidos nucléicos alimentares, citando os produtos formados nesse processo.

resposta:a) Glicose.
Só a glicose é formada a partir da maltose originária da digestão do amido no suco entérico, no qual é encontrada a maltase. Dessa forma, a concentração de glicose aumenta, inicialmente, no jejuno e, a seguir, no íleo, decaindo, com o passar do tempo, em função de sua absorção. Nenhuma das outras substâncias testadas apresentaria um perfil similar.

b) O suco pancreático, por conter as enzimas nucleases - desoxirribonuclease e ribonuclease -, digere, por hidrólise, respectivamente, as moléculas de DNA e RNA.
Os produtos formados são: desoxirribonucleotídios e ribonucleotídios.

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:Em um experimento, solicitou-se a uma pessoa que respirasse o ar existente dentro de um saco plástico durante alguns minutos. Foram medidos, antes e durante o período de respiração do ar contido no saco, os seguintes parâmetros:

1 - pressão parcial do O‚ no sangue;
2 - concentração de H‚COƒ no sangue;
3 - pressão parcial do CO‚ no saco plástico.

Observe os gráficos orientados a seguir, nos quais as ordenadas representam as medidas desses parâmetros e as abcissas, o tempo de duração do experimento.




O gráfico que representa adequadamente a variação dos três parâmetros nas condições experimentais é o identificado pela letra:
a) W
b) X
c) Y
d) Z


resposta:[A]

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:As células de nosso organismo metabolizam glicídios, lipídios e proteínas usados para fins energéticos ou para sintetizar componentes de sua própria estrutura. O esquema adiante apresenta algumas etapas importantes do metabolismo energético no fígado.




a) Suponha uma dieta alimentar cuja quantidade de carboidratos ingerida esteja acima da necessidade energética média de uma pessoa. Dentre as etapas metabólicas apresentadas, cite duas que devem ser ativadas para promover acúmulo de gordura no organismo dessa pessoa.
b) Nomeie um hormônio que seja capaz de induzir o processo de gliconeogênese no fígado e indique onde esse hormônio é produzido.

resposta:a) 3 (glicólise)
7 (síntese de ácidos graxos)

b) Um dentre os hormônios e respectivo local de produção:
- adrenalina - medula da supra-renal
- glucagon - pâncreas
- glicocorticóides - córtex da supra-renal

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:O oxigênio é um elemento imprescindível à manutenção da vida dos seres aeróbicos, pois participa do processo de extração de energia dos alimentos, como aceptor final de elétrons, conforme exemplificado pela reação abaixo.

C†H‚O† + 6 O‚ ë 6 H‚O + 6 CO‚

Em virtude de sua configuração eletrônica, o oxigênio tem forte tendência a receber um elétron de cada vez, dando origem a moléculas intermediárias, denominadas espécies reativas de oxigênio, que são fortes agentes oxidantes. Essas moléculas, por serem muito reativas, causam alterações, inclusive no DNA, fato que pode induzir mutações tanto em células somáticas quanto em células germinativas.

a) Considerando o processo de oxidação completa da glicose pela célula eucariótica, indique a etapa responsável pela formação de espécies reativas de oxigênio e o local da célula onde essas reações ocorrem.
b) Uma espécie reativa de oxigênio induziu uma mutação no gene de uma célula, acarretando a substituição de uma base guanina por uma adenina, sem alterar, porém, a estrutura primária da proteína codificada pelo gene. Justifique por que não houve alteração da estrutura da proteína.

resposta:a) Cadeia respiratória.
Membrana interna da mitocôndria.

b) Como o código genético é degenerado, ou seja, existe mais de um códon para a maioria dos aminoácidos, o códon alterado pode pertencer ao mesmo aminoácido que teria sido inserido na cadeia polipeptídica antes da mutação.

origem:Uerj
tópico:
Biologia

sub-grupo:

pergunta:A luz solar traz inúmeros benefícios para os seres vivos. Um de seus componentes, a radiação ultravioleta, UV, é responsável, no entanto, por alguns efeitos indesejáveis. A ilustração adiante resume a atuação dos diferentes tipos de radiação UV sobre a pele humana.




UV A - Corresponde à maior parte do espectro da radiação ultravioleta, atingindo, inclusive, áreas mais profundas da pele e produzindo alterações que podem levar ao fotoenvelhecimento e ao câncer.
UV B - Penetra pouco na pele; responsável pela vermelhidão e por queimaduras após a exposição ao sol, também pode causar o câncer de pele.
UV C - É normalmente absorvida pela camada de ozônio antes de chegar à Terra.

a) Cite o tipo de radiação UV que tem maior efeito estimulante sobre a pigmentação da pele e justifique sua resposta.
b) Cite o tipo de célula presente em maior quantidade na hipoderme e explique a importância dessa camada para a adaptação de animais ao clima frio.

resposta:a) UV A
Como as células produtoras de melanina, denominadas de melanócitos, estão localizadas na parte mais profunda da epiderme, elas serão mais estimuladas pela radiação UV A, que apresenta maior penetração.

b) Células adiposas ou adipócitos.
O maior desenvolvimento dessa camada em animais de clima frio permite um melhor isolamento térmico e um acúmulo de reservas energéticas.

 


Próxima Página »

Página 1 de 2